Chapter 5 part 2 - questions

•From the following figures:

•Which molecule its repetition in a successive manner at the end of a certain nucleic acid protects it from being damaged ?

(4)
(3)
(2)
(1)

•The opposite graph illustrates the temperature required for the action of PCR machine, by knowing that the optimal temperature for the activity of Taq polymerase enzyme is 72°C , at which stage are the new nucleotides added to the new strand pairing with the nucleotides of the original strand?

(Z)
(X)
(Y)
(L)

•Which of the following organisms have more complement DNA strands when decreasing The temperature, in case of mixing them together?

•(1) frog, (2) Hydra, (3) spirogyra, (4) anopheles mosquito, (5) aphid insects

(2) and (3)
(1) and (2)
(4) and (5)
(2) and (4)

The following table illustrates the strands of different DNA samples and the temperatures required to break the hydrogen bonds between the nitrogenous bases of each two strands, which choice illustrates the samples in which the evolutionary relationship is the closest ?

A
B
C
D

•Which of the following organisms cells doesn’t have the same number of chromosomal sets ?

E.coli bacteria
Gametophyte of polypodium
Sporophyte of polypodium
Spirogyra alga

•The opposite graph shows the effect of temperature on the separation of DNA molecules into single strands, which of the following could be deduced from the data illustrated in the graph

When the temperature reaches 85°C , all the double stranded DNA molecules disappear
When the temperature reaches 85°C, the DNA molecules separate faster.
85°C temperature refers to the separated DNA molecules.
The separation of DNA molecules into single strands is directly proportional in a regular manner to the increase in temperature.

•From the opposite figure: Which of the following enzymes has no role in separating (1) from (2)?

Restriction enzyme
Helicase
Deoxyribonuclease
Reverse transcriptase

•To produce insulin protein from a bacterial cell, a part of ………. Is added to the bacterial cell

Insulin gene
Insulin hormone
Bacterial DNA
Human DNA

The following figure illustrates the action of restriction enzymes on each of DNA molecules no. (1) and (2), study it, then answer: Which choice in the following table is correct?

A
B
C
D

•If one of the restriction enzymes recognizes the nucleotides sequence (AAGCTT) and cuts the segment between the two adenine bases . How many DNA segments will be produced when a segment from the following DNA molecule is treated with this enzymes

5’… TTAAGCTTAAGAAGAAGCTT … 3’

3′ … AATTCGAATTCTTCTTCGAA … s’

2
3
4
5

•In the genetic engineering field, many genetic screening tests can be done to be applied to human. What is the importance of these tests?

Detecting the presence or absence of a specific gene.
Detecting the presence of a defect in the number of chromosomes.
Detecting the presence of abnormal chromosomes.
Determining the embryo sex .

•The opposite figure shows a bacterial cell that will be used in insulin production, (Q) was inserted through this technique, what does (Q) represent ?

A gene from a healthy person.
Cells from human pancreas.
DNA from another bacterial cell.
Human insulin molecules.

A bacterial cell plasmid was treated with a restriction enzyme leading to the production of the opposite figure : Which of the following can be used with the opposite figure for the formation of the recombinant DNA ?

A
B
C
D

•Which of the following statements isn’t applied to the restriction enzymes ?

They cut the nucleic acid molecules at specific sequences.
They affect all types of nucleic acids.
They affect the DNA molecules whatever their source.
They represent an important tool for the recombinant nucleic acid technology.

•Taq polymerase enzyme that is used in replicating the pieces of DNA in PCR machine is extracted from

Penicillium fungus.
E.coli bacteria.
thermophilic bacteria.
yeast fungus.

•Before producing insulin by using the recombinant DNA, the insulin that was extracted from catties and pigs was given to the patients, the most important problem that faced this treatment was that the insulin .

was inactive.
caused the production of antibodies in some patients.
caused a loss in the patients' weight.
caused amnesia.

•If we want to obtain casein protein from bacteria, which of the following mechanisms can be used ?

Recombinant DNA
Hybrid DNA
DNA replication
RNA transcription

Which of the following represents a recognition sequence for a restriction enzyme?

A
B
C
D

•Which of the following characterizes the human hormones that are produced by genetic engineering ?

They have poor quality, because they are produced by bacteria.
They have high quality and have the same action of the natural hormone.
They have weaker action than the chemically synthesized hormones.
They are identical to the hormones which are extracted from catties.

•Which of the following isn’t from the applications of the recombinant nucleic acid technique

Modifying plants to make them more resistant to pests.
Producing genetically modified plants.
Producing human proteins in the bacterial cells.
Using bacteria to detect the presence of carcinogenic compounds.

•Which of the following doesn’t agree with the opposite figure ?

(X) represents an enzyme which breaks down the weak bonds
Enzyme (X) can be replaced by rising the temperature to 100oC
The opposite nucleotides are linked after their separation during the action of enzyme (X)
Enzyme (X) works at the beginning of replication

Chapter 5 part 2 – questions

Quiz Summary

Information

Results

Results

Categories

1. Question

2. Question

3. Question

4. Question

5. Question

6. Question

7. Question

8. Question

9. Question

10. Question

11. Question

12. Question

13. Question

14. Question

15. Question

16. Question

17. Question

18. Question

19. Question

20. Question

21. Question